IDEAS home Printed from https://ideas.repec.org/a/nat/natcom/v9y2018i1d10.1038_s41467-018-06909-4.html
   My bibliography  Save this article

Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria

Author

Listed:
  • Chen Dong

    (University of Washington)

  • Jason Fontana

    (University of Washington)

  • Anika Patel

    (University of Washington)

  • James M. Carothers

    (University of Washington
    University of Washington
    University of Washington)

  • Jesse G. Zalatan

    (University of Washington
    University of Washington
    University of Washington)

Abstract

In the original version of the Supplementary Information file associated with this Article, the sequence ‘1x MS2 scRNA.b2’ was incorrectly given as ‘GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCGCACATGAGGATCACCCATGTGCTTTTTT’ and should have read ‘GAAGATCCGGCCTGCAGCCAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACATGAGGATCACCCATGTGCTTTTTTT’. The error has now been fixed and the corrected version of the Supplementary Information PDF is available to download from the HTML version of the Article.

Suggested Citation

  • Chen Dong & Jason Fontana & Anika Patel & James M. Carothers & Jesse G. Zalatan, 2018. "Author Correction: Synthetic CRISPR-Cas gene activators for transcriptional reprogramming in bacteria," Nature Communications, Nature, vol. 9(1), pages 1-1, December.
  • Handle: RePEc:nat:natcom:v:9:y:2018:i:1:d:10.1038_s41467-018-06909-4
    DOI: 10.1038/s41467-018-06909-4
    as

    Download full text from publisher

    File URL: https://www.nature.com/articles/s41467-018-06909-4
    File Function: Abstract
    Download Restriction: no

    File URL: https://libkey.io/10.1038/s41467-018-06909-4?utm_source=ideas
    LibKey link: if access is restricted and if your library uses this service, LibKey will redirect you to where you can use your library subscription to access this item
    ---><---

    Citations

    Citations are extracted by the CitEc Project, subscribe to its RSS feed for this item.
    as


    Cited by:

    1. Giho Kim & Ho Joon Kim & Keonwoo Kim & Hyeon Jin Kim & Jina Yang & Sang Woo Seo, 2024. "Tunable translation-level CRISPR interference by dCas13 and engineered gRNA in bacteria," Nature Communications, Nature, vol. 15(1), pages 1-13, December.
    2. William M. Shaw & Lucie Studená & Kyler Roy & Piotr Hapeta & Nicholas S. McCarty & Alicia E. Graham & Tom Ellis & Rodrigo Ledesma-Amaro, 2022. "Inducible expression of large gRNA arrays for multiplexed CRISPRai applications," Nature Communications, Nature, vol. 13(1), pages 1-10, December.

    More about this item

    Statistics

    Access and download statistics

    Corrections

    All material on this site has been provided by the respective publishers and authors. You can help correct errors and omissions. When requesting a correction, please mention this item's handle: RePEc:nat:natcom:v:9:y:2018:i:1:d:10.1038_s41467-018-06909-4. See general information about how to correct material in RePEc.

    If you have authored this item and are not yet registered with RePEc, we encourage you to do it here. This allows to link your profile to this item. It also allows you to accept potential citations to this item that we are uncertain about.

    We have no bibliographic references for this item. You can help adding them by using this form .

    If you know of missing items citing this one, you can help us creating those links by adding the relevant references in the same way as above, for each refering item. If you are a registered author of this item, you may also want to check the "citations" tab in your RePEc Author Service profile, as there may be some citations waiting for confirmation.

    For technical questions regarding this item, or to correct its authors, title, abstract, bibliographic or download information, contact: Sonal Shukla or Springer Nature Abstracting and Indexing (email available below). General contact details of provider: http://www.nature.com .

    Please note that corrections may take a couple of weeks to filter through the various RePEc services.

    IDEAS is a RePEc service. RePEc uses bibliographic data supplied by the respective publishers.